View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8748_high_16 (Length: 269)
Name: NF8748_high_16
Description: NF8748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8748_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 129 - 252
Target Start/End: Complemental strand, 4387966 - 4387843
Alignment:
| Q |
129 |
atttgaaaattgtattcacaaaaaattaaacctcatttgaaaattgaacaagaagagggaaaaaataatgtccaattagaagatgaagaatctctctatt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4387966 |
atttgaaaattgtattcacaaaaaattaaacctcatttgaaaattgaacaagaagagggaaaaaataatgtccaattagaagatgaagaatctctctatt |
4387867 |
T |
 |
| Q |
229 |
gttaattcattcgatgcctttgct |
252 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4387866 |
gttaattcattcgatgcctttgct |
4387843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University