View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8748_high_21 (Length: 241)
Name: NF8748_high_21
Description: NF8748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8748_high_21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 40774879 - 40774657
Alignment:
| Q |
19 |
acagaaaccttctccattgccctagcaaaatcttgaaagaaagcttgttcatcttttgcatataactccacaattggcttggtccttggatcagaaccca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40774879 |
acagaaaccttctccattgccctagcaaaatcttgaaagaaagcttgttcatctcttgcatataactccacaattggcttggtccttggatcagaaccca |
40774780 |
T |
 |
| Q |
119 |
acatagcatctgttctcaataaacccaaacctttcaacacattttggtaatatgcattgtcaaatttccctggtgacctaacatcattaaaagcagccat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40774779 |
acatagcatctgttctcaataaacccaaacctttcaacacattttggtaatatgcattgtcaaatttccctggtgacctaacatcattaaaagcagccat |
40774680 |
T |
 |
| Q |
219 |
attagggtcagtagtgtagtttt |
241 |
Q |
| |
|
||||||||||||||| ||||||| |
|
|
| T |
40774679 |
attagggtcagtagtatagtttt |
40774657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University