View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8748_high_23 (Length: 240)

Name: NF8748_high_23
Description: NF8748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8748_high_23
NF8748_high_23
[»] chr5 (4 HSPs)
chr5 (27-217)||(41103600-41103802)
chr5 (33-133)||(41089218-41089322)
chr5 (90-133)||(41081238-41081281)
chr5 (33-69)||(41081208-41081244)
[»] chr1 (2 HSPs)
chr1 (151-219)||(4132133-4132201)
chr1 (71-133)||(4132243-4132306)


Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 27 - 217
Target Start/End: Original strand, 41103600 - 41103802
Alignment:
27 ttatactgtcttgcttaggattggtcgaaataagtgattggaggttagtaatatgctta-cagaattggagctgcaagattcatgggacctcaatgtgca 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
41103600 ttatactgtcttgcttaggattggtcgaaataagtgattggaggttagtaatatgcttatcagaattggagctgcaagattcatgggacctcaatgtgca 41103699  T
126 acaatgaggcatagaagatttggtt-----------ttggattatgaactattttctggtttttgcttgtttagaagtgtgttgtttcaatttctgtcaa 214  Q
    |||||||||||||||||||||||||           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41103700 acaatgaggcatagaagatttggttttggaactgtattggattatgaactattttctggtttttgcttgtttagaagtgtgttgtttcaatttctgtcaa 41103799  T
215 gca 217  Q
    |||    
41103800 gca 41103802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 33 - 133
Target Start/End: Original strand, 41089218 - 41089322
Alignment:
33 tgtcttgcttaggattggtcgaaataagtgattggaggttagtaatatgctta-cagaattggagctg---caagattcatgggacctcaatgtgcaaca 128  Q
    ||||||||||||||||||| |||||| ||||||| ||||||||||||||||||  |||||||||||||   || |||||||| ||||| ||| ||||| |    
41089218 tgtcttgcttaggattggtagaaatatgtgattgtaggttagtaatatgcttatgagaattggagctgcatcatgattcatgtgaccttaatatgcaaga 41089317  T
129 atgag 133  Q
    |||||    
41089318 atgag 41089322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 90 - 133
Target Start/End: Original strand, 41081238 - 41081281
Alignment:
90 attggagctgcaagattcatgggacctcaatgtgcaacaatgag 133  Q
    |||||||||||||||||||||| |||||||||||||| ||||||    
41081238 attggagctgcaagattcatggaacctcaatgtgcaagaatgag 41081281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 69
Target Start/End: Original strand, 41081208 - 41081244
Alignment:
33 tgtcttgcttaggattggtcgaaataagtgattggag 69  Q
    ||||||||| ||||||||| |||||||||||||||||    
41081208 tgtcttgctcaggattggtagaaataagtgattggag 41081244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 151 - 219
Target Start/End: Complemental strand, 4132201 - 4132133
Alignment:
151 ttggattatgaactattttctggtttttgcttgtttagaagtgtgttgtttcaatttctgtcaagcaag 219  Q
    |||| |||||||||||||||| |||||||||||||| |||||||| ||||||  |||||| ||| ||||    
4132201 ttggtttatgaactattttctagtttttgcttgtttggaagtgtggtgtttctctttctgccaaccaag 4132133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 71 - 133
Target Start/End: Complemental strand, 4132306 - 4132243
Alignment:
71 ttagtaatatgctta-cagaattggagctgcaagattcatgggacctcaatgtgcaacaatgag 133  Q
    |||||||||| |||| ||||||||||||| || |||||||||||||||||| |||| |||||||    
4132306 ttagtaatatacttatcagaattggagctacatgattcatgggacctcaatatgcagcaatgag 4132243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University