View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8748_low_13 (Length: 355)
Name: NF8748_low_13
Description: NF8748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8748_low_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 18 - 355
Target Start/End: Original strand, 3590343 - 3590682
Alignment:
| Q |
18 |
cttctcagcttgaatgtggactttggaagtcacttattgagtttacttcatctttt-tcaaggatcgattcctttgttctctacacaaagatatatcatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3590343 |
cttctcagcttgaatgtggactttggaagtcacttattgagtttacttcatcttttttcaaggatcgattcctttgttctctacacaaagatatatcatc |
3590442 |
T |
 |
| Q |
117 |
ttaccaactcctaaggaggttttccagtttcatagtgaccaaggattgggatgtttatggtggctggtatatcaaaatatatgtctgcctaactctatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3590443 |
ttaccaactcctaaggaggttttccagtttcatagtgaccaaggattgggatgtttatggtggctggtatatcaaaatatatgtctgcctaactctatat |
3590542 |
T |
 |
| Q |
217 |
acgggatccgttgatctagacttagacttccaaaactgcttcatcaccttcttcctttccccagatgttttgaatctcattaattcagagaatgatacca |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3590543 |
acgggatccgttgatctagacttagacttccaaaactgcttcatcaccttcttcctttccccagatgttttgaatctcattaattcagagaatgatacca |
3590642 |
T |
 |
| Q |
317 |
atagcaagttcaggattggg-aatggtttgtgtcaatggc |
355 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
3590643 |
atagcaagttcaggattgggaaatggtctgtgtcaatggc |
3590682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University