View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8748_low_36 (Length: 231)
Name: NF8748_low_36
Description: NF8748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8748_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 5550830 - 5551044
Alignment:
| Q |
1 |
ccattcatgagcatgcgtgccctatcacttggccatgataaggtcacccacgcatcaatccaagaggtgacaaaataacataaggcaaagtgtgcgctgg |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5550830 |
ccattcatgagcatgcgtgccccatcacttggccatgctaaggtcacccacgcatcaatccaagaggtgacaaaataacataaggcaaagtatgcgctgg |
5550929 |
T |
 |
| Q |
101 |
agaaaaatgccatgccactaaacaaaatattgccaacccacttaagtaactacccattaaaattctactagtcaatttcttgtacattaataggttgtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5550930 |
agaaaaatgccatgccactaaacaaaatattgccaacccacttaagtaactacccattaaaattctactagtcaatttcttgtacattaataggttgtga |
5551029 |
T |
 |
| Q |
201 |
tcttttacatctttt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
5551030 |
tcttttacatctttt |
5551044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University