View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8749_high_10 (Length: 251)
Name: NF8749_high_10
Description: NF8749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8749_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 38748457 - 38748241
Alignment:
| Q |
19 |
cccacacaatgactctgactcagactccgacgatccttactcttctgaccattttcgcatgtatgaattcaaagtccgccgctgcactcgtagccggagc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38748457 |
cccacacaatgactctgactcagactccgacgatccttactcttccgaccattttcgcatgtatgaattcaaagtccgccgctgcactcgtagccggagc |
38748358 |
T |
|
| Q |
119 |
cacgactggactgactgtccatttgctcaccccggtgagaaagctcgccgccgtgatccacggcggtttcattactcagggacggtttgccctgagtatc |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38748357 |
cacgactggactgactgtccattcgctcaccccggtgagaaagctcgccgccgtgatccacggcggtttcattactcagggacagtttgccctgagtatc |
38748258 |
T |
|
| Q |
219 |
gccgcggtggctgtaac |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38748257 |
gccgcggtggctgtaac |
38748241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 77 - 135
Target Start/End: Original strand, 30385537 - 30385595
Alignment:
| Q |
77 |
atgtatgaattcaaagtccgccgctgcactcgtagccggagccacgactggactgactg |
135 |
Q |
| |
|
||||| || |||||| |||| || ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30385537 |
atgtacgagttcaaaatccggcgatgcacccgtagccggagccacgactggactgactg |
30385595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 42926378 - 42926326
Alignment:
| Q |
122 |
gactggactgactgtccatttgctcaccccggtgagaaagctcgccgccgtga |
174 |
Q |
| |
|
|||||||| || ||||| ||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
42926378 |
gactggacggagtgtcctttttctcatcccggcgagaaagctcgccgccgtga |
42926326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University