View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8749_high_12 (Length: 240)
Name: NF8749_high_12
Description: NF8749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8749_high_12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 14212936 - 14212713
Alignment:
| Q |
18 |
tggtgtattatcaggtcatgctttatggagagattccatggtggagcagttattgcagcaataattcagcaaattatatgtaagattaatcaatgagaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14212936 |
tggtgtattatcaggtcatgctttatggagagattccatggtggagcagttattgcagcaataattcagcaaattatatgtaagattaatcaatgagaga |
14212837 |
T |
 |
| Q |
118 |
aattaactttctgtgttttgaagttcaatagtttgaggaataaagtagggactaaacatgat-tgaaatgttagctcaatgatatgataaaatattgata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14212836 |
aattaactttctgtgttttgaagttcaatagtttgaggaataaagtagggactaaacatgatatgaaatgttagctcaatgatatgataaaatattgata |
14212737 |
T |
 |
| Q |
217 |
agaagagataatattattggcaag |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
14212736 |
agaagagataatattattggcaag |
14212713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University