View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8749_high_14 (Length: 237)
Name: NF8749_high_14
Description: NF8749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8749_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 150 - 222
Target Start/End: Complemental strand, 54385984 - 54385912
Alignment:
| Q |
150 |
gctggagaatctctgatcttttttgttacatttatacacaaattcattgttctctctcattcatagttcatgc |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
54385984 |
gctggagaatccctgatcttttttgttacatttatacacaaattcatttttctctctcattcatagttcatgc |
54385912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 54392243 - 54392179
Alignment:
| Q |
1 |
tacacaagtttatagatcttaccatgcattcgctccattatatcggacttcttctactcatgaat |
65 |
Q |
| |
|
|||||||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54392243 |
tacacaagcttatagatcttaccatgtattcactccattatatcggacttcttctactcatgaat |
54392179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University