View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8749_low_14 (Length: 259)
Name: NF8749_low_14
Description: NF8749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8749_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 29688060 - 29688299
Alignment:
| Q |
1 |
ctggctagatgcatgactgccgccacttgcctttttcacccgccgctgcatggctttaccgttgttagaggtcgtaaacaagtagttaggtatagttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29688060 |
ctggctagatgcatgactgccgccacttgcctttttcacccgccgctgcatggctttaccgttgttagaggtcgtaaacaagtagttaggtatagttcac |
29688159 |
T |
|
| Q |
101 |
tatcttttttaatactcaaaacaagtagttgcgtattaatgctctttctatttctctcttattaatttgcatgttatctactaacatttttctatccaaa |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29688160 |
taccttttttaatactcaaaacaagtagttgcgtattaatgctctttctatttctctcttattaatttgcatgttatctactaacatttttctatccaaa |
29688259 |
T |
|
| Q |
201 |
tggcaccaacattattattattgtcattagagaggaccaaact |
243 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
29688260 |
tggcagcaac---attattattgtcattagagaggatcaaact |
29688299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University