View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8749_low_21 (Length: 245)
Name: NF8749_low_21
Description: NF8749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8749_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 16 - 225
Target Start/End: Complemental strand, 26313207 - 26312999
Alignment:
| Q |
16 |
acatcacaactatgtcagaaccccacaaaccaacaataattttcaaagtaaaaaccacaacaaaaagaaacatgtgaaaatcagtttgnnnnnnnnnnnn |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26313207 |
acatcacaactatgtcagaaccccacaaaccaacaataattttcaaagttaaaaccacaacaaaaagaaacatgtgaaaatcagtttgtttttctttttt |
26313108 |
T |
|
| Q |
116 |
nggctcttcaagatgtcagtgaaaatctcagagtcaacgttttcattgttcatcagtttatgtgttaactcaaggtctttttgttaaacaagatggctat |
215 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26313107 |
tggctcttcaagatgttagtgaaaatctcagagtca-cgttttcattgttcatcggtttatgtgttaactcaaggtctttttgtaaaacaagatggctat |
26313009 |
T |
|
| Q |
216 |
gtggagggta |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
26313008 |
gtggagggta |
26312999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 165
Target Start/End: Complemental strand, 1334389 - 1334357
Alignment:
| Q |
133 |
agtgaaaatctcagagtcaacgttttcattgtt |
165 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
1334389 |
agtgaaaatctcagagtcaacattttcattgtt |
1334357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University