View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8749_low_22 (Length: 244)
Name: NF8749_low_22
Description: NF8749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8749_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 14212658 - 14212536
Alignment:
| Q |
38 |
atattagtactttatcttctaagagtgacttactgatatggacagggatgtatccaataccagctgtgtatcttctacttcagttcaacatgaacaaaga |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14212658 |
atattagtactttatcttctaagagtgacttactgatatggacagggatgtatccaataccagctgtgtatcttctacttcagttcaacatgaacaaaga |
14212559 |
T |
|
| Q |
138 |
ttgaaaacttgcaatacagtaag |
160 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14212558 |
ttgaaaacttgcaatacagtaag |
14212536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University