View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8749_low_28 (Length: 227)
Name: NF8749_low_28
Description: NF8749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8749_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 209
Target Start/End: Complemental strand, 38762730 - 38762537
Alignment:
| Q |
16 |
aagaagaaggtaatcactgggagacagttagtagtggcagcggccaaagttgcagaagtgtttattagagcaataccatatatgtccaaactcgatgtga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762730 |
aagaagaaggtaatcactgggagacagttagtagtggcagcggccaaagttgcagaagtgtttattagagcaataccatatatgtccaaactcgatgtga |
38762631 |
T |
 |
| Q |
116 |
tcctgatcatagatcaacaaatttcattatatattatatagtttttgttttggtgtgtaaaagaagtggtaaacaccgactctcacatataact |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38762630 |
tcctgatcatagatcaacaaatttcattatatattatatagtttttgttttggtgtgtaaaagaagtggtaaacacagactctcacatataact |
38762537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University