View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8749_low_29 (Length: 226)
Name: NF8749_low_29
Description: NF8749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8749_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 137 - 216
Target Start/End: Complemental strand, 8399809 - 8399730
Alignment:
| Q |
137 |
gagttcttaacaatggtgttactttgtcagttgaaaccagacctagaaactctcaagaatatcagttatagatgctgggt |
216 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8399809 |
gagttcttaacaatggtgttactttttcagttgaaaccagacctagaaactcacaagaatatcagttatagatgctgggt |
8399730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 95 - 142
Target Start/End: Complemental strand, 8399886 - 8399839
Alignment:
| Q |
95 |
atcttgtactggtcttgtaaaatgaaaatgacctccttgtttgagttc |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
8399886 |
atcttgtactggtcttgtaaaatgaaaatgacatccttgtttcagttc |
8399839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 98 - 142
Target Start/End: Original strand, 5363665 - 5363709
Alignment:
| Q |
98 |
ttgtactggtcttgtaaaatgaaaatgacctccttgtttgagttc |
142 |
Q |
| |
|
||||||| |||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
5363665 |
ttgtacttgtctagtaaaatgaaaatgtcctacttgtttgagttc |
5363709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University