View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8749_low_6 (Length: 460)
Name: NF8749_low_6
Description: NF8749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8749_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 69 - 445
Target Start/End: Original strand, 42738410 - 42738786
Alignment:
| Q |
69 |
tgaaaattaggaagaaatggaggaggtgataatttttggtatgaaactagcattttcacttgctcttgtgggtattttgagctggattttttatatttat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42738410 |
tgaaaattaggaagaaatggaggaggtgataatttttggtatgaaactagcattttcacttgctcttgtgggtattttgagctggattttttatatttat |
42738509 |
T |
|
| Q |
169 |
ggcactttgtggtataagtcccaaagggtaagaagaaagctcagaatgcaaggtattagagggcctccaccttcttcttttctacatgggaatctacctg |
268 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42738510 |
ggcactttgtggtataattcccaaagggtaagaagaaagctcagaatgcaaggtattagagggcctccaccttcttcttttctacatgggaatctacctg |
42738609 |
T |
|
| Q |
269 |
atatgcagagaattacatcgcaagctagcaatatttccaaagataatgatcagtttctagcttatgattactctgcagctctgttcccatattttcaaca |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42738610 |
atatgcagagaattacatcgcaagctagcaatatttccaaagataatgatcagtttctagcttatgattactctgcagctctgttcccatattttcaaca |
42738709 |
T |
|
| Q |
369 |
ctggaggaaacaatacggtatatacccttctcttccttttcattcttcttttttccagtttcattgttaacattcat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42738710 |
ctggaggaaacaatacggtatatacccttctcttccttttcattcttcttttttccagtttcattgttaacattcat |
42738786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University