View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8751_high_15 (Length: 250)
Name: NF8751_high_15
Description: NF8751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8751_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 15903882 - 15903645
Alignment:
| Q |
1 |
tagttagcttgtttagtttgtatatgcggttaggttataggttataagaaagggatcggggccttgagtttaccctcctcacacttcaccaaaataagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15903882 |
tagttagcttgtttagtttgtatatgcagttaggttataggttataagaaagggatcggggccttgagtttaccctcctcacacttcaccaaaataagaa |
15903783 |
T |
 |
| Q |
101 |
gtctaccaccttgtgaattataggtttccattgactagtactactatctttggaaagaatttgctactaaatttctgctgtgattgcattgggttattta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15903782 |
gtctaccaccttgtgaattataggtttccattgactagtactactatctttggaaataatttgctactaaatttctgctgtgattgcattgggtta-tta |
15903684 |
T |
 |
| Q |
201 |
gaatgaatgtctttttaaaattattatatatttgtctgt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15903683 |
taatgaatgtctttttaaaattattatatatttgtctgt |
15903645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University