View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8751_high_20 (Length: 215)
Name: NF8751_high_20
Description: NF8751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8751_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 15904183 - 15903999
Alignment:
| Q |
18 |
cactagactcacctattgctttgcttcttcactgggtatggttgtgtacttttttgttgcagccacatttatgtcgtccattgttgtcattgacagtgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15904183 |
cactagactcacctattgctttgcttcttcactgggtatggttgtgtacttttttgttgcagccacatttatgtcgtccattgttgtcattgacagtgtt |
15904084 |
T |
|
| Q |
118 |
atagcgtagggggttttggtgaatccactatgaaaaccatgacactgtcggctatttcacataacagatttttgcctgcaacacc |
202 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15904083 |
acagcgtagggggttttggtgaatccactatgaaaaccatgacactgtcggctatttcacataacagatttttgcctgcaacacc |
15903999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University