View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8751_low_15 (Length: 307)
Name: NF8751_low_15
Description: NF8751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8751_low_15 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 307
Target Start/End: Original strand, 54217649 - 54217955
Alignment:
| Q |
1 |
gcaatgcaacttgtgcactacaattcgtcgtcctagctcactcgtatcgttccataaacttatacaacaaccaaattaggctcgttcgccaaagctgagt |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
54217649 |
gcaatgcaacttgtgcacgacaattcgtcgtcctagctcactcgtgtcgttccataaacttatacaacaatcaaattaggcttgttcgccaaagctgagt |
54217748 |
T |
|
| Q |
101 |
taagcttgtcacaaaggaaaacgacattgtatagcaggtcaaggtcattttgaatttacttggaattcaagttagtcaaaaatttaaccaagatctaacg |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54217749 |
tgagcttgtcacaaaggaaaacgacattgtatagtaggtcaaggtcattttgaatttacttggaattcaagttagtaaaaaatttaaccaagatctaacg |
54217848 |
T |
|
| Q |
201 |
tgtttatgggttcgacaaacggatatgttaattacacaacaaactatgtaggaaataacaccaccgaacaacgtagcaaccaaagaagagaaccattgtg |
300 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54217849 |
tgtttatgagttcgacaaacggatatgttaattacacaacaaactatgtaggaaataacaccaccgaacaacgtagcaaccaaagaagagaaccattgtg |
54217948 |
T |
|
| Q |
301 |
gggtaaa |
307 |
Q |
| |
|
||||||| |
|
|
| T |
54217949 |
gggtaaa |
54217955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University