View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8751_low_17 (Length: 287)
Name: NF8751_low_17
Description: NF8751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8751_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 145 - 270
Target Start/End: Original strand, 6861417 - 6861539
Alignment:
| Q |
145 |
gtagctctaggttaaggctctactattaagtggtctacagcttctctacgatccgtattttgaccccctaatggtgtacgctaatgtgtggaagagaaca |
244 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6861417 |
gtagctctaggttaaggttctactattaagtggtctacagcttctctacgatccgtattttgaccccctaatggtgtacgctaatgtgtggaagag---a |
6861513 |
T |
|
| Q |
245 |
acaacaacaccagatatgctattaaa |
270 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
6861514 |
acaacaacaccagatatgctgttaaa |
6861539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 23 - 121
Target Start/End: Original strand, 6861289 - 6861387
Alignment:
| Q |
23 |
ggacattgaaagagatttaagaaggtcccaagttcgatctccataactaacactctcccgctcccctctaacaattactaacaagtaacattttcctat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6861289 |
ggacattgaaagagatttaagaaggtcccaagttcgatctccataactaacactctcccgctcccctctaacaattactaacaactaacattttcctat |
6861387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University