View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8751_low_20 (Length: 251)
Name: NF8751_low_20
Description: NF8751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8751_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 43559989 - 43560215
Alignment:
| Q |
18 |
gcttgctggtgaaaatttctcttgaagcttctgttaagccattatcatcatagtaactcgaatcggttattagaaatgctgaaccatgtgatgtaattga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43559989 |
gcttgctggtgaaaatttctcttgaagcttctgttaagccattatcatcatagtaactcgaatcagttattagaaatgctgaaccatgtgatgtaattga |
43560088 |
T |
|
| Q |
118 |
tggtatttgcatagatggtactgttgtttctgtgattttgttctcttccttaagatatgcttctgtaagaggcttgtgtgttgttggatcaatcccttgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43560089 |
tggtatttgcatagatggtactgttgtttctgtgattttgttctcttccttaagatatgcttctgtaagaggcttgtgtgttgttggatcaatcccttgc |
43560188 |
T |
|
| Q |
218 |
tttagaagcttcttctttaaacacgaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43560189 |
tttagaagcttcttctttaaacacgaa |
43560215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 24 - 147
Target Start/End: Original strand, 1992574 - 1992697
Alignment:
| Q |
24 |
tggtgaaaatttctcttgaagcttctgttaagccattatcatcatagtaactcgaatcggttattagaaatgctgaaccatgtgatgtaattgatggtat |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1992574 |
tggtgaaaatttctcttgaagcttctgttaaaccattatcatcatagtaactcgaatcggttattagaaatgctgaaccatgtgatgtaactgatggtat |
1992673 |
T |
|
| Q |
124 |
ttgcatagatggtactgttgtttc |
147 |
Q |
| |
|
|||||||| |||| |||||||||| |
|
|
| T |
1992674 |
ttgcataggtggtgctgttgtttc |
1992697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University