View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8751_low_21 (Length: 251)
Name: NF8751_low_21
Description: NF8751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8751_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 245
Target Start/End: Original strand, 52300979 - 52301216
Alignment:
| Q |
16 |
tctgcatatcgctgcttttgtcttaggcta--------gtaattaacgatgaagaactcatttagatggagctgttattactttgtgctaatcaatatgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52300979 |
tctgcatatcgctgcttttgtcttaggctactaattaagtaattaacgatgaagaactcatttagatggagctgttattactttgtgctaatcaatatgt |
52301078 |
T |
|
| Q |
108 |
tcatgttgcattttacagtaaggtcccaactgacaacagacttctataagtcatcttgtcctaaccttacaaagatagtaaggaaagaggttgtaaaagc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52301079 |
tcatgttgcattttacagtaaggtcccaactgacaacagacttctataagtcatcttgtcctaaccttacaaagatagtaaggaaagaggttgtaaaagc |
52301178 |
T |
|
| Q |
208 |
tctaaagaatgagatgagaatgggtgcttctctgcttc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52301179 |
tctaaagaatgagatgagaatgggtgcttctttgcttc |
52301216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University