View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8751_low_27 (Length: 223)
Name: NF8751_low_27
Description: NF8751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8751_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 47 - 153
Target Start/End: Original strand, 51710874 - 51710980
Alignment:
| Q |
47 |
atctctctgtaattttattactctaataattcaaagtgtgacaatataggttcacactgttacttctccatgtgcacagattcgatgcagagaataaagg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51710874 |
atctctctgtaattttattactctaataattcaaagtgtgacaatataggttcacactgttacttctccatgtgcacagattcgatgcagagaataaagg |
51710973 |
T |
|
| Q |
147 |
atgcttt |
153 |
Q |
| |
|
||||||| |
|
|
| T |
51710974 |
atgcttt |
51710980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 135 - 206
Target Start/End: Original strand, 51710995 - 51711066
Alignment:
| Q |
135 |
agagaataaaggatgctttattatcagaacatgaagaacactttaatcattatttacttcaataataaatat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51710995 |
agagaataaaggatgctttattatcagaacatgaagaacactttaatcattatttacttcaataataaatat |
51711066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University