View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8752_low_12 (Length: 346)
Name: NF8752_low_12
Description: NF8752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8752_low_12 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 15 - 333
Target Start/End: Original strand, 76932 - 77233
Alignment:
| Q |
15 |
tcaattttgtccctaaacttctctagcaatcgaacaaattgatactaaatcagcaaacaaattaaaaatgcaacatgatcttgaaggtgaaagtcctcga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
76932 |
tcaattttgtccctaaacttctctagcaatcgaacaaattgatacaaaa-----------------aatgcaacatgatcttgaaggtgaaagtcctcga |
77014 |
T |
|
| Q |
115 |
tcaagttaatctcgttaggaaatatcggtagcgatggccaaaattgaccgatctaaataaagttaatgctaatgtgattgaagattttcaatttattgac |
214 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
77015 |
tcaagttaatctcgttaggaaacatcggtagcgatggccaaaattgaccgatctaaataaagttaatgctaatgtgattgaaggttttcaatttattgac |
77114 |
T |
|
| Q |
215 |
tgttttcaaattttgttaattataagatcgaattcacataaatgttttgtgaacacatttttgacatcaacaacttatatactgatttttatgttatttt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
77115 |
tgttttcaaattttgttaattataagatcgaattcacataaatgttttgtgaacacattttcgacatcaacaacttatatactgatttttttgttgtttt |
77214 |
T |
|
| Q |
315 |
tcctttcttcggttcttct |
333 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
77215 |
tcctttcttcggttcttct |
77233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University