View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8752_low_13 (Length: 334)
Name: NF8752_low_13
Description: NF8752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8752_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 6 - 318
Target Start/End: Original strand, 4487646 - 4487962
Alignment:
| Q |
6 |
gtcttagattttgctcttctaattttgaaatttctatgttatatttttgtgttgtgattgaatccttttattttctctatgctgattttctccaacacca |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4487646 |
gtcttagtttttgctcttctaattttgaagtttctatgttatatttttgtgttgtgattgagtctttttattttctctatgccgattttctccaacacca |
4487745 |
T |
 |
| Q |
106 |
ccaacgttgcctaaccccgcgttatacaggttgatggtgaggcacgcgggtagtgtgtgaagatacaaagctaggaagggagtggatat----gagggtg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4487746 |
ccaacgttgcctaaccccgcgttatacaggttgatggcgaggcgcgcgggtagtgtgtgaagatacaaagctaggaagggagtggatatgaacgagggtg |
4487845 |
T |
 |
| Q |
202 |
gagccatgaggatgtggccattgtgtgaagatgactgtggtttgttgggcagctgtcttatgtgggcacgggtcccccacgaatgtctgtcttccatcct |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4487846 |
gagccatgaggatgtggccattgtgtgaagatgactgtggtttgttgggcagctgtcttatgtgggcacgggtcccccacgaatgtctgtcttccatcct |
4487945 |
T |
 |
| Q |
302 |
tccaaaatagttgatct |
318 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
4487946 |
tccaaaatagttgatct |
4487962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University