View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8752_low_15 (Length: 317)
Name: NF8752_low_15
Description: NF8752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8752_low_15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 12 - 317
Target Start/End: Original strand, 34685343 - 34685658
Alignment:
| Q |
12 |
ataatactcctctttaattatactcatatttttctctt--aggnnnnnnnntactcatgttttttattcatttatttcagtccactattccccaatggag |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34685343 |
ataacactcctctttaattatactcatatttttctctctcagaaaaaaaaatactcatgttttttattcatttatttcagtccactattccccaatggag |
34685442 |
T |
 |
| Q |
110 |
ttgccatagttcaactaaacttattcaacttatgatggttccggtcatatttaaattgggacactctcaatcaattcaaatttaactaaaattcagcaat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34685443 |
ttgccatagttcaactaaacttattcaacttatgatggttccggtcatatttaaattgggacactctcaatcaattcaactttaactaaaattcagcaat |
34685542 |
T |
 |
| Q |
210 |
aatttgaattctaaaatgtgattccatacatcttatacatct--------atgaccaaaattgtgttgcagccgttcacttctcaacacacacacaacta |
301 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34685543 |
aacttgaattctaacatgtgattccatacatcttatacatctacacatgaatgaccaaaattgtgttgcaaccgttcacttctcaacacacacacaacta |
34685642 |
T |
 |
| Q |
302 |
tattattaccagcagc |
317 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34685643 |
tattattaccagcagc |
34685658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University