View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8752_low_18 (Length: 252)
Name: NF8752_low_18
Description: NF8752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8752_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 235
Target Start/End: Complemental strand, 41077000 - 41076785
Alignment:
| Q |
19 |
gtttagtcagaacagaacgcactggttccactcacctctgtaccccatatacttatctcgctgttaataatgctttgtgtatccaaagcaagccataact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077000 |
gtttagtcagaacagaacgcactggttccactcacctctgtaccccatatacttatctcgctgttaataatgctttgtgtatccaaagcaagccataact |
41076901 |
T |
 |
| Q |
119 |
taatctcaaattttggtagcagaatattgtgtgttgaatttcacccattttcttttctgagaatgatctcaaaacnnnnnnncaatgttgatgcacggtc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41076900 |
taatctcaaattttggtagcagaatattgtgtgttgaatttcacccattttcttttctgagaatgatctcaaaac-ggggggcaatgttgatgcacggtc |
41076802 |
T |
 |
| Q |
219 |
caagtaatggtaacctt |
235 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41076801 |
caagtaatggtaacctt |
41076785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University