View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8752_low_19 (Length: 250)
Name: NF8752_low_19
Description: NF8752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8752_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 119 - 239
Target Start/End: Original strand, 39185319 - 39185439
Alignment:
| Q |
119 |
agcaatagcagcaagtctcagagacccaacagaacgatataaaccccaatcctaagagtcccaaactcgaattcgaagatacaacaacgaatctgaaaca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39185319 |
agcaatagcagcaagtctcagagacccaacagaacgatagaaaccccaatcctaagagacccaaactcgaattcaaagatacaacaacgaatctgaaaca |
39185418 |
T |
 |
| Q |
219 |
aaaacacaaaccacaggttct |
239 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
39185419 |
aaaacacaaaacacaggttct |
39185439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University