View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8752_low_7 (Length: 433)
Name: NF8752_low_7
Description: NF8752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8752_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 97 - 401
Target Start/End: Complemental strand, 32557798 - 32557494
Alignment:
| Q |
97 |
ccataagaaatgtgtactgaaggataggtaaaaaaggggacaaggatgtgggttgtctggaaattgggtccaaaccaagattaagggtgtatgagaggag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557798 |
ccataagaaatgtgtactgaaggataggtaaaaaaggggacaaggatgtgggttgtctgggaattgggtccaaaccaagattaagggtgtatgagaggag |
32557699 |
T |
|
| Q |
197 |
aagggaataggtggcaagcaaggagtgagagagtaggaaagagatgtgggaatcctgaatgcagtggggggagaatgagtatttattcgggtatagtatt |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557698 |
aagggaataggtggcaagcaaggagtgagagagtaggaaagagatgtgggaatcctgaatgcagtggggggagaatgagtatttattcgggtatagtatt |
32557599 |
T |
|
| Q |
297 |
agttctctttcaagattgggtttatccttttctgttttgttattgatcatcttgccaagggtattgcgttaccattttaattatttctggcttgcagtat |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557598 |
agttctctttcaagattgggtttatccttttctgttttgttattgatcatcttgccaggggtattgcgttaccattttaattatttctggcttgcagtat |
32557499 |
T |
|
| Q |
397 |
tatct |
401 |
Q |
| |
|
||||| |
|
|
| T |
32557498 |
tatct |
32557494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 32557838 - 32557796
Alignment:
| Q |
18 |
aaaagaaccttcaagtatgtattgaatcccatcttcccatcca |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557838 |
aaaagaaccttcaagtatgtattgaatcccatcttcccatcca |
32557796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University