View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8753_low_9 (Length: 202)
Name: NF8753_low_9
Description: NF8753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8753_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 192
Target Start/End: Original strand, 8860133 - 8860309
Alignment:
| Q |
16 |
tttacttgacttagaagaaggaggaatggagtataataaaaatcaaaatttgaatagagaaagtgtactacatacatatgaggtttgatgatattgctaa |
115 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
8860133 |
tttacttgacttagaagagggaggaatggagtataataaaaatcaaaatttgaatagagaaagtgtactacatatatgtgaggtttgatgatattgctaa |
8860232 |
T |
 |
| Q |
116 |
gctaggaatagaacataaaattgcgaccataggtttgtgaaaaccatatgtaaaaatctgatgagtagtataatcta |
192 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8860233 |
gctaggaatagaacacaaagttgcgaccataggtttgtgaaaaccatatgtaaaaatctgatgagtagtatagtcta |
8860309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University