View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8754_high_4 (Length: 247)
Name: NF8754_high_4
Description: NF8754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8754_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 70 - 150
Target Start/End: Original strand, 31407017 - 31407099
Alignment:
| Q |
70 |
ttagtggtattttactatttgaaaattaaacgaccaaagtctagcgcaaatgattggtgtgcaatg--tgtgagtgttgtaaa |
150 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||| ||| |||||| ||||||||||||||| |
|
|
| T |
31407017 |
ttagtggtatttaactatttgaaaattaaacgatcaaagtctagcgcaaatgattagtgcgcaatgtatgtgagtgttgtaaa |
31407099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 148 - 228
Target Start/End: Original strand, 31407140 - 31407220
Alignment:
| Q |
148 |
aaactatttgaatatgaaaa-ggtgaaattttttaccattcttggagcaccatcaatctcagcaacctccatgccagttact |
228 |
Q |
| |
|
|||||||||||| ||||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31407140 |
aaactatttgaaaatgaaaaaggtgaaaaattt-accattcttggagcaccatcaatctcagcaacctccatgccagttact |
31407220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 31406981 - 31407019
Alignment:
| Q |
1 |
catatcagtatgacactagccatataaaaatgtctctta |
39 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31406981 |
catatcagtatgacactagccatatcaaaatgtctctta |
31407019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 179 - 224
Target Start/End: Original strand, 47481273 - 47481318
Alignment:
| Q |
179 |
ttaccattcttggagcaccatcaatctcagcaacctccatgccagt |
224 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| ||||| ||||| |
|
|
| T |
47481273 |
ttaccattcttggggcaccatcaatttcagcaacttccataccagt |
47481318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University