View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8754_high_8 (Length: 234)
Name: NF8754_high_8
Description: NF8754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8754_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 46936911 - 46937111
Alignment:
| Q |
1 |
cgataaattaggaagaaagaggagaggataactacagctataaatcagaaccaaatcttgcacttattcatcttagtgttgtatacgnnnnnnnnnnnnt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | | |
|
|
| T |
46936911 |
cgataaattaggaggaaagaggagaggataactacagctataaatcagaaccaaatcttgcacttattcatcttagtgttaaaaa--------------t |
46936996 |
T |
 |
| Q |
101 |
taaagataaccttgatattggaattctgctctttaagatatttcccaacacctgttatggtaccaccagtacctataccactgacaaatgcatcaacttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46936997 |
taaagataaccttgatattggaattctgctctttaagatatttcccaacacctgttatggtaccaccagtacctataccactgacaaatgcatcaacttt |
46937096 |
T |
 |
| Q |
201 |
ccctcctgtgccttt |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46937097 |
ccctcctgtgccttt |
46937111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 107 - 203
Target Start/End: Complemental strand, 862694 - 862598
Alignment:
| Q |
107 |
taaccttgatattggaattctgctctttaagatatttcccaacacctgttatggtaccaccagtacctataccactgacaaatgcatcaactttccc |
203 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||| ||| |||||||| |||| |||||| |
|
|
| T |
862694 |
taacctttatattggaattttgctctttaagatatttcccagcaccggttatggtaccaccagtacctatcccagaaacaaatgcgtcaattttccc |
862598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University