View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8754_low_4 (Length: 279)
Name: NF8754_low_4
Description: NF8754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8754_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 45687368 - 45687631
Alignment:
| Q |
1 |
ggaagattcgatttatctattccgatcgccggaagtcaccggagacaccgtggacttgagacggaaatcatagaaacgtttccgacttttgtttactcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45687368 |
ggaagattcgatttatctattccgatcgccggaagtcaccggagacaccgtggacttgagacggaaatcattgaaacgtttccgacttttgtttactcca |
45687467 |
T |
|
| Q |
101 |
ccgtgaaaggactcaaaataggaagagctgcactagaatgcgccgtgtgcttaaacgagtttcaagacgatgaaacgctgcgtttgattccgaattgtag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45687468 |
ccgtgaaaggactcaaaataggaagagctgcactagaatgcgccgtgtgcttaaacgagtttcaagacgatgaaacgctgcgtttgattccgaattgtag |
45687567 |
T |
|
| Q |
201 |
ccacgtgttccattctcaatgtgtcgatgcttggcttgttaatcactccacgtgtcccgtttgt |
264 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45687568 |
ccacgtgtttcattctcaatgtgtcgatgcttggcttgttaatcactccacgtgtcccgtttgt |
45687631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 134 - 203
Target Start/End: Original strand, 27320403 - 27320472
Alignment:
| Q |
134 |
tagaatgcgccgtgtgcttaaacgagtttcaagacgatgaaacgctgcgtttgattccgaattgtagcca |
203 |
Q |
| |
|
||||||| || ||||| ||||| |||||| || ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27320403 |
tagaatgtgcagtgtgtttaaatgagtttgcggatgatgaaacgctgcgtttgattcctaattgtagcca |
27320472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University