View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8755_high_13 (Length: 383)
Name: NF8755_high_13
Description: NF8755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8755_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 368
Target Start/End: Original strand, 22247241 - 22247594
Alignment:
| Q |
1 |
ttttttcaaaagttcatttttgttttgtaagtggtacgttcgttgagcgaatgaaaattactttaacaacatatttttgtcagctcagtcatgtgggact |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22247241 |
ttttttcaaaagttcatttttgtcttgtaagtggttcgttcgttgagcgtatggaaattactttaacaacatatttttgttagctcagtcatgtgggact |
22247340 |
T |
 |
| Q |
101 |
taaactatcatcacttgagtcatttcttcgctttgcgattttgccctacttcaaaacatgagcctcttacttgaatcgataaactactactctgcttgcc |
200 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
22247341 |
taaattgtcatcacttgagtcatttcttcgctttgcgattttgccctacttcaaaacatgagcctcttacttgaatcgctagactactactatgcttgcc |
22247440 |
T |
 |
| Q |
201 |
aagcgagtagcttgatttgcttctttatagctctttgtctggggccattcactcttttgctctaaatcactacaaattgtgttagaaacaaggtaaaaga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
22247441 |
aagcgagtagcttgatttgcttctttatagctctttgtctggggccattcagtcttttggtctaaatcactacaaattgtgtt--------------aga |
22247526 |
T |
 |
| Q |
301 |
aaagggaatgcaatggtgacctaattatacaatatttacatgaaatgagggatttttaaatggtttct |
368 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22247527 |
aaaaggaatgcaatggtgacctaattatacaatatttacatgaaatgagggatttttaaatggtttct |
22247594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University