View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8755_high_21 (Length: 267)
Name: NF8755_high_21
Description: NF8755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8755_high_21 |
 | |
|
| [»] scaffold0039 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 254
Target Start/End: Complemental strand, 43102430 - 43102195
Alignment:
| Q |
19 |
gttcctcatcgcttatgtttggttaacgggcttacaccgcacaacttggacagcaccaagccaggagtgtctcaccggctggaagcctttactccgactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102430 |
gttcctcatcgcttatgtttggttaacgggcttacaccgcacaacttggacagcaccaagtcaggagtgtctcaccggctggaagcctttactccgactt |
43102331 |
T |
|
| Q |
119 |
gccacgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggaccccaccgtaaccattgctt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43102330 |
gccacgccaagctgcgtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtggtttacttgtggaccccaccgttaccattgctt |
43102231 |
T |
|
| Q |
219 |
ctatcgggattctaattcaaactacttcattcattt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43102230 |
ctatcgggattctaattcaaactacttcattcattt |
43102195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 125 - 166
Target Start/End: Original strand, 24241 - 24282
Alignment:
| Q |
125 |
ccaagctgcgtttccgtttgtttggaatggtggtggtatgaa |
166 |
Q |
| |
|
|||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
24241 |
ccaagctgcgtttctgtctgcttggaatggtggtggtatgaa |
24282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 134 - 186
Target Start/End: Original strand, 51874979 - 51875031
Alignment:
| Q |
134 |
gtttccgtttgtttggaatggtggtggtatgaagtaatgatcattttatgtgg |
186 |
Q |
| |
|
||||| |||||||| |||||||||||||||||| | ||||| ||||| ||||| |
|
|
| T |
51874979 |
gtttctgtttgtttagaatggtggtggtatgaactcatgataattttgtgtgg |
51875031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University