View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8755_high_23 (Length: 250)
Name: NF8755_high_23
Description: NF8755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8755_high_23 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 29032843 - 29032610
Alignment:
| Q |
17 |
aagaaaatcaccactgttgaacttagtgacatggcggtgttgagatttttgctgcttatgattatggcatggatgaagaaggttttgttcggtggtttcg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
29032843 |
aagaaaatcaccactgttgaacttagtgacatggcggtgttgagatttttgctgcttatgattatggaatggatgaagaaggttttgttcggttgtttcg |
29032744 |
T |
|
| Q |
117 |
ggatagaagaaattggttcgagctttggaaccgcgcatggatagagcggcggagtcgtaggcgcaagcagcttgttcggcggtatcgaaagttccgagcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29032743 |
ggatagaagaaattggttcgagctttggaaccgcgcatggatagagcggcggagtcgtaggcgcaagcagcttgttcggcggtatcgaaagttccgagcc |
29032644 |
T |
|
| Q |
217 |
agcggcgttctttggaatgtgggtctcttatctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29032643 |
agcggcgttctttggaatgtgggtctcttatctc |
29032610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 14158661 - 14158612
Alignment:
| Q |
201 |
tcgaaagttccgagccagcggcgttctttggaatgtgggtctcttatctc |
250 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
14158661 |
tcgaaggttccaagccagcggcgttctttggactgagggtctcttatctc |
14158612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University