View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8755_high_25 (Length: 249)
Name: NF8755_high_25
Description: NF8755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8755_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 14209553 - 14209314
Alignment:
| Q |
1 |
tttctgcatcctgggatggaattggatgaaagacttttggcatgtatgtgcatgtataattatgcctcagggaaaggtattgtccttgtcagtttttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14209553 |
tttctgcatcctgggatggaattggatgaaagacttttggcatgtatgtgcatgtataattatgcctcagggaaaggtattgtccttgtcagtttttctt |
14209454 |
T |
|
| Q |
101 |
gttttatgaggcttgtccttacctcagttatgttacttaacaaatgtcacgacaatggcaattcatctaaattgaactcaacaaattcagcacttgggtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14209453 |
gttttatgaggcttgtccttacctcagttatgttacttaaaaaatgtcacgacaatggcaattcatctaaattgaactcaacaaattcagcacttaggtt |
14209354 |
T |
|
| Q |
201 |
ctgtttggattggtttatttgagtttatttactagtataa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14209353 |
ctgtttggattggtttatttgagtttatttactagtataa |
14209314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 202 - 235
Target Start/End: Complemental strand, 26717378 - 26717345
Alignment:
| Q |
202 |
tgtttggattggtttatttgagtttatttactag |
235 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
26717378 |
tgtttggattggtttatttgagtttatctactag |
26717345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 232
Target Start/End: Original strand, 36643794 - 36643826
Alignment:
| Q |
200 |
tctgtttggattggtttatttgagtttatttac |
232 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
36643794 |
tctgtttggattggtttatttgagcttatttac |
36643826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 200 - 233
Target Start/End: Complemental strand, 25719824 - 25719791
Alignment:
| Q |
200 |
tctgtttggattggtttatttgagtttatttact |
233 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
25719824 |
tctgtttggattgatttatttgagtttatttact |
25719791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 228
Target Start/End: Complemental strand, 7941759 - 7941731
Alignment:
| Q |
200 |
tctgtttggattggtttatttgagtttat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7941759 |
tctgtttggattggtttatttgagtttat |
7941731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University