View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8755_high_31 (Length: 207)
Name: NF8755_high_31
Description: NF8755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8755_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 185
Target Start/End: Original strand, 10509388 - 10509557
Alignment:
| Q |
17 |
cagagatccagatgtttcgaatccgcttcattggctcagacatagtagctgctgctgcgtttcttcaacttctagggtttgtttt-tgatagaaaacaat |
115 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10509388 |
cagagatccagatgtttcgaatctgcttcattggctcagacatggttgctgctgctgcgtttcttcaacttctagggtttgttttttgatagaaaacaat |
10509487 |
T |
 |
| Q |
116 |
agaaatgaaatggaaattgtgctatgtaaaaccctttgggtagtgcttatgccttatagcatgtgatatc |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10509488 |
agaaatgaaatggaaattgtgctatgtaaaaccctttgggtagtgcttatgccttatagcatgtgatatc |
10509557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 157
Target Start/End: Original strand, 10495183 - 10495313
Alignment:
| Q |
17 |
cagagatccagatgtttcgaatccgcttcattggctcagacatagtagctgctgctgcgtttcttcaacttctagggtttgtttttgatagaaaacaata |
116 |
Q |
| |
|
|||| ||||||| ||| |||||| ||| |||||| |||||||| || |||||||||||||||| ||||||| |||||| |||||||||||||| |
|
|
| T |
10495183 |
cagatatccagacgttgcgaatctgctccattggttcagacatggttgctgctgctgcgtttc---aacttct----tttgtt---gatagaaaacaata |
10495272 |
T |
 |
| Q |
117 |
gaaatgaaatggaaatt-gtgctatgtaaaaccctttgggta |
157 |
Q |
| |
|
||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
10495273 |
gaa-tgaaatggaattgcgtgctatgtaaaaccctttgggta |
10495313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University