View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8755_low_21 (Length: 298)
Name: NF8755_low_21
Description: NF8755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8755_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 10330509 - 10330794
Alignment:
| Q |
1 |
ttattgtgtaacatttcattgcaggataatatagagcacacttgaatatgagataataatctcgattgaatgtattcggttgaagaatcttactgagtta |
100 |
Q |
| |
|
||||||| ||| |||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
10330509 |
ttattgtctaatatttcattgcaggataatgtagagcacacttgaatatgagattataatctcgattgaatgtattcagttgaagaatcttaca-agtta |
10330607 |
T |
|
| Q |
101 |
atatctattttgaagaaatagcatatcccctttgtataaggtcacttaaaaacatttgattcctttaaaaatttcgttgtttggtaagagatttatgtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10330608 |
atatctattttgaagaaatagcatattccctttgtataaggtcacttgaaaacatttgattcctttaaaaatttcgttgtttggtaagagatttatgtca |
10330707 |
T |
|
| Q |
201 |
caaaattccatcggcaccaaattcaaatcttttgttagactatatcacaaaatttggaaaattataccatgtccaccgtctctgctt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10330708 |
caaaattccatcggcaccaaattcaaatcttttgttagactatatcacaaaatttggaaaattataccatgtccaccgtccctgctt |
10330794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University