View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8755_low_31 (Length: 237)

Name: NF8755_low_31
Description: NF8755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8755_low_31
NF8755_low_31
[»] chr3 (1 HSPs)
chr3 (143-237)||(53950632-53950726)


Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 143 - 237
Target Start/End: Complemental strand, 53950726 - 53950632
Alignment:
143 tttcatcaccacttttaatccttattttttgcttagcatggtatcacactacttacaaaacaaccttaagttccactaattgaaacccctaattt 237  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |||||    
53950726 tttcatcaccgcttttaatccttattttttgcttagcatggtatcacactacttacaaatcaacctcaagttccactaattgaaacccccaattt 53950632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University