View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8755_low_32 (Length: 236)
Name: NF8755_low_32
Description: NF8755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8755_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 30156300 - 30156503
Alignment:
| Q |
10 |
tcgagtgagaagaaatcaaatggttctgggcagttgtatgatgatcaaaatgggaggaagaagaaaattgagaagaatgagttgactgttattgatcatc |
109 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30156300 |
tcgaatgaaaagaaatcaaatggttctgggcagttgtatgatgatcaaaatgggaggaagaagaaaattgagaagaatgagttgactgttattgatcatc |
30156399 |
T |
|
| Q |
110 |
ctggatttggaagagttccaaaggctatagaagccgaacaagttgcggctggatggccggcgtggctttcttctgttgctggtgatgctatcaagggatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30156400 |
ctggatttggaagagttccaaaggctatagaagccgaacaagttgcggctggatggccggcgtggctttcttctgttgctggtgatgctattaagggatg |
30156499 |
T |
|
| Q |
210 |
gatt |
213 |
Q |
| |
|
|||| |
|
|
| T |
30156500 |
gatt |
30156503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 118 - 203
Target Start/End: Original strand, 38537759 - 38537844
Alignment:
| Q |
118 |
ggaagagttccaaaggctatagaagccgaacaagttgcggctggatggccggcgtggctttcttctgttgctggtgatgctatcaa |
203 |
Q |
| |
|
||||| |||||||||||| |||||| ||| |||||||| || |||||||| | ||||||||||||||||||||||| |||||||| |
|
|
| T |
38537759 |
ggaagggttccaaaggctttagaaggcgagcaagttgcagcaggatggccaacttggctttcttctgttgctggtgaagctatcaa |
38537844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 124 - 210
Target Start/End: Complemental strand, 33271882 - 33271796
Alignment:
| Q |
124 |
gttccaaaggctatagaagccgaacaagttgcggctggatggccggcgtggctttcttctgttgctggtgatgctatcaagggatgg |
210 |
Q |
| |
|
||||| |||||||| |||| || || |||||||||||||||||| | ||||| | | |||||||||||||| |||||||||||| |
|
|
| T |
33271882 |
gttcctaaggctatggaaggggagcatgttgcggctggatggccgtcatggctggcagcagttgctggtgatgcaatcaagggatgg |
33271796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University