View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8755_low_34 (Length: 220)
Name: NF8755_low_34
Description: NF8755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8755_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 10 - 205
Target Start/End: Original strand, 5961759 - 5961956
Alignment:
| Q |
10 |
catcatcaattggaacaatcattggtttagtcagttgatttagtttgttgcagg--ttttttcccttctgttattttctgtatgcagctgttgttgcttc |
107 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5961759 |
catcataaattggaacaatcattggtttagtcagttggtttagtttgttgctgggtttttttcccttctgttattttctgtatgcagctattgttgcttc |
5961858 |
T |
|
| Q |
108 |
tgtatcaggtgctgttttttggctgcttgttgtacggctgttagggagtttatttcctgctgtttggggcgctgccctactgtttttagttggttctt |
205 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
5961859 |
tgtattaggtgctgttttttggctgcttgttgtacggctgttagggagtttatttcctgctgtttggggcgctgccgtgttgtttttagttggttctt |
5961956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 10 - 205
Target Start/End: Complemental strand, 31647108 - 31646918
Alignment:
| Q |
10 |
catcatcaattggaacaatcattggtttag---tcagttgatttagtttgttgcaggtttttt----cccttctgttattttctgtatgcagctgttgtt |
102 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| ||||||| ||||||||||||| |||||||| ||||| ||||||||| |||||| || ||||||| |
|
|
| T |
31647108 |
catcataaattgaaacaatcattggtttagccttcagttggtttagtttgttgctggttttttttttcccttgtgttattttatgtatgtagttgttgtt |
31647009 |
T |
|
| Q |
103 |
gcttctgtatcaggtgctgttttttggctgcttgttgtacggctgttagggagtttatttcctgctgtttggggcgctgccctactgtttttagttggtt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |||| |||||| ||||||||||||||| |
|
|
| T |
31647008 |
gcttctgtatcaggtgctgttttttggctgctt--------gctgttagggagtttatttcctg----ttgtggcgatgccctgttgtttttagttggtt |
31646921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University