View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8756_high_13 (Length: 387)
Name: NF8756_high_13
Description: NF8756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8756_high_13 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 84 - 387
Target Start/End: Original strand, 44574358 - 44574660
Alignment:
| Q |
84 |
ttagatgatctttagaaacttttatctttcatcataataaccatttctaaaatgatgtgaagatatttattaaaaccttgtgtttctgatctttattttt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44574358 |
ttagatgatctttagaaacttttatctttcatcataatatccatttctaaaatgatgtgaagatatttattaa--ccttgtgtttctgatctttattttt |
44574455 |
T |
 |
| Q |
184 |
gggaaggaaattgcatgtcccactaaataactgttctccaagctcatccaagtgattcttgagctctgatggtcccaagttggaggacacgtcttgcttt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44574456 |
gggaaggaaattgcatgtcccactaaataactgttctccaagctcatccaggtgattcttgagctctgatggtaccaagttggaggacacgtcttgcttt |
44574555 |
T |
 |
| Q |
284 |
accaacaataaatctatccctccaatgctaagacccacaaggatgtgagtcccaaagttctcgatgaatctgat-aaaaaggttaagttttcaagaacat |
382 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
44574556 |
accaacaataaatctttccctccaatgctaagacccacaagaatgtgagtcccaaagttctcgatgaatctgataaaaaaggttaatatttcaagaacat |
44574655 |
T |
 |
| Q |
383 |
aaatt |
387 |
Q |
| |
|
||||| |
|
|
| T |
44574656 |
aaatt |
44574660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 17 - 61
Target Start/End: Original strand, 44574308 - 44574352
Alignment:
| Q |
17 |
caacgatttgcggaccaaaaacatcgaaggctgctggaacctgtg |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44574308 |
caacgatttgcggaccaaaaacatcgaaggctgctggtacctgtg |
44574352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University