View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8756_high_22 (Length: 250)
Name: NF8756_high_22
Description: NF8756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8756_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 53 - 169
Target Start/End: Original strand, 44574686 - 44574802
Alignment:
| Q |
53 |
atttttacaactttttatgatagtcttaaaattagttcctctagactacaaactcaaacttttactaacttcagacttttatttttgaaatattagaaaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574686 |
atttttacaactttttatgatagtcttaaaattagttcctctagactacaaactcaaacttttactaacttcagacttttatttttgaaatattagaaaa |
44574785 |
T |
 |
| Q |
153 |
atagactactggtggta |
169 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44574786 |
atagactactggtggta |
44574802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 174 - 240
Target Start/End: Original strand, 44574904 - 44574970
Alignment:
| Q |
174 |
ctaacaaaaggatgatttaataattgaactatcaacgttgcacgactccgttcaatcaaattctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574904 |
ctaacaaaaggatgatttaataattgaactatcaacgttgcacgactccgttcaatcaaattctctg |
44574970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University