View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8756_low_11 (Length: 400)
Name: NF8756_low_11
Description: NF8756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8756_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 1 - 388
Target Start/End: Complemental strand, 42050932 - 42050545
Alignment:
| Q |
1 |
tgcctatcattatcataattcattcatatatttcactattcacattcnnnnnnnnnnnnnaaagaacctacaccccttctttctcaaggtttgatatctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42050932 |
tgcctatcattatcataattcattcatatatttcactattcacattctttttctttttttaaagaacctacaccccttctttctcaaggtttgatatctt |
42050833 |
T |
 |
| Q |
101 |
ttttgcattctctctttctttggccccaaacattaacaccacatcattctttctcct-ctccatctccatcagttgctggtgagtggagttagaagttga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42050832 |
ttttgcattctctctttctttggccccaaacattaacaccacatcattctttcttcttctccatctccatcagttgctggtgagtggagttagaagttga |
42050733 |
T |
 |
| Q |
200 |
cannnnnnnnnnnnnnnnnnaagccgttttagcgccaccatttcatgagataatcttttcctgaaatctagctccaaacttaacaacagataaaggagag |
299 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42050732 |
catctctctctctctctct-aagccgttttagcgccaccatttcatgagataagcttttcctgaaatctagctccaaacttaacaacagataaaggagag |
42050634 |
T |
 |
| Q |
300 |
agaaactattgaaaagatgatttattagggctatagtttcatttcatcaactcttaaaactctcattttccttccttcactttcatctc |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42050633 |
agaaactattgaaaagatgatttattagggctatagtttcatttcatcaactcttaaaactctcattttccttccttcactttcatctc |
42050545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University