View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8756_low_26 (Length: 269)
Name: NF8756_low_26
Description: NF8756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8756_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 254
Target Start/End: Complemental strand, 38476175 - 38475927
Alignment:
| Q |
8 |
gagtagcagagagacaccgacaa-tagacacgtctttgatcaaaagtgtttgataagaatttttcatagtta-gagaaattaccggctatacagaaagtg |
105 |
Q |
| |
|
||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38476175 |
gagtatcagagagacaccgacaactggacacgtctttgatcaaaagtgtttgataagaatttttcatagttaagagaaattaccggctatacagaaagtg |
38476076 |
T |
|
| Q |
106 |
gatttttcccagcgagatttgcaaattgaagcatcatatccaagactcaacaatccatcaataacaaattttctacaattatcatctttgcgtttgcaca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38476075 |
gatttttcccagcgagatttgcaaattgaagcatcatatccaagactcaacaatccatcaataacaaattttctacaattatcatctttgcgtttgcaca |
38475976 |
T |
|
| Q |
206 |
aagttttgttcttctcaattatctttgttgtgtctgctaacaagtttct |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38475975 |
aagttttgttcttctcaattatctttgttgtgtctgctaacaagtttct |
38475927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University