View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8756_low_7 (Length: 475)
Name: NF8756_low_7
Description: NF8756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8756_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 219 - 445
Target Start/End: Complemental strand, 493500 - 493274
Alignment:
| Q |
219 |
tcattgttttgggtatttaacatgatgtttgacttgtgtaacttactattttataggttaccttacaattggaacccctcttcaagcgatctattacgta |
318 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
493500 |
tcattgttttgggtttttaacatgatgtttgacttgtgtaacttgctattttataggttaccttacaattggaacccctcttcaaacgatctcttacgta |
493401 |
T |
|
| Q |
319 |
tttgacaaaaaacgatactgatttgggtgatgaattgatcacttttggcaacaagcatgaatttgccgatgtaacatggtatccaagtcaacaaaaggtt |
418 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
493400 |
tttgacaaaaaacgattctgatttgggtgatgaattgatcacttttggtaaaaagcatgaatttgccgatgtaacatggtatccaagtcaacaaaaggtt |
493301 |
T |
|
| Q |
419 |
ctttatagaattgatgatcgtgtctct |
445 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
493300 |
ctttatagaattgatgatcgtgtctct |
493274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 19 - 192
Target Start/End: Complemental strand, 493694 - 493525
Alignment:
| Q |
19 |
tatgtaacacatattagaatagttagccctgcaggatgtgaagatggatatgctaaggttcgaaatcttaatgaatctcaccaagatcttaatgcagcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
493694 |
tatgtaacacatattagaatagttagccctgcaggatgtgaagatggatatgctaaggttcgaaatcttaatgaatctcatcaagatcttaatgcagcca |
493595 |
T |
|
| Q |
119 |
gagtttctttaggggttcttggagttatttctcaggtatatatgcatgctccttttgttttgtatgtctagtag |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
493594 |
gagtttctttaggggttcttggagttatttctcagg----tatgcatgttccttttgttttgtatgtctagtag |
493525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University