View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8757_high_16 (Length: 238)
Name: NF8757_high_16
Description: NF8757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8757_high_16 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 8211482 - 8211704
Alignment:
| Q |
16 |
aaaacaactcaaacaaaacataaaccctaattcaataaccccaggctcatgcatcagctcctgggacttcacctttgacccatgtgacaatctcttcagt |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8211482 |
aaaacaactcaaacaaaacataaaccgtaattcaataaccccaggctcatgcatcagctcctgggacttcacctttgacccatgtgacaatctcttcagt |
8211581 |
T |
|
| Q |
116 |
gaaaaattcacctgcggattcagatgtgacacaatcatctccaatctgagtcgagtcactgaactcagtctcgaccaagctggttactcaggctcactta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8211582 |
gaaaaattcacctgcggattcagatgtgacaccatcatctccaatctgagtcgagtcactgaactcactctcgaccaagctggttactcaggctcactta |
8211681 |
T |
|
| Q |
216 |
gcatagacaattttccttatctc |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8211682 |
gcatagacaattttccttatctc |
8211704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University