View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8757_high_19 (Length: 218)
Name: NF8757_high_19
Description: NF8757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8757_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 204
Target Start/End: Complemental strand, 25542118 - 25541934
Alignment:
| Q |
20 |
tggtctgatacggatgttgttgattttttgtatggattgttgatacttgattgcaagtttctattttagatatgatgtggttgtttctagtagttgagtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25542118 |
tggtctgatacggatgttgttgattttttgtatggattgttgatacttgattgcaagtttctattttagatatgatgtggttgtttctagtagttgagtt |
25542019 |
T |
|
| Q |
120 |
tgtgaaatggatacatttattgtaaccttgacctttgatgaaattttatcggttggaaatatatttgtgtagtttatgatataat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25542018 |
tgtgaaatggatacatttattgtaaccttgacctttgatgaaattttatcggttggaaatatatttgtgtagtttatgatataat |
25541934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 173
Target Start/End: Complemental strand, 11980412 - 11980274
Alignment:
| Q |
20 |
tggtctgatacggatgttgttgattttttgtatggattgttgatacttgattgcaagtttctattttagatatgatgtggttgtttctagtagttgagtt |
119 |
Q |
| |
|
|||||||||| | |||||||||||||| ||||||||||||||| ||| ||||| |||| ||||||||||| ||||||||||| |||| |
|
|
| T |
11980412 |
tggtctgatatgaatgttgttgatttt--gtatggattgttgat-------tgcgagtttatattatagatatgatgcggttgtttctat------agtt |
11980328 |
T |
|
| Q |
120 |
tgtgaaatggatacatttattgtaaccttgacctttgatgaaattttatcggtt |
173 |
Q |
| |
|
|| |||| |||| ||||| ||||||||||| || ||||||||||||||| |||| |
|
|
| T |
11980327 |
tgggaaagggattcatttgttgtaaccttgtccattgatgaaattttataggtt |
11980274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 137
Target Start/End: Complemental strand, 11980746 - 11980634
Alignment:
| Q |
20 |
tggtctgatacggatgttgttgattttttgtatggattgttgatacttgattgcaagtttctattttagatatgatgtggttgtttc---tagtagttga |
116 |
Q |
| |
|
||||| ||| || ||||||||||||||||||||||||||| ||||||||||||| |||| |||| ||||||| |||||||| |||||||||| |
|
|
| T |
11980746 |
tggtcagatgcgaatgttgttgattttttgtatggattgt-------tgattgcaagtttatattatagagatgatgttgttgtttctaatagtagttga |
11980654 |
T |
|
| Q |
117 |
gtttgtgaaatggatacattt |
137 |
Q |
| |
|
| ||| ||||||||| ||||| |
|
|
| T |
11980653 |
g-ttgggaaatggattcattt |
11980634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 204
Target Start/End: Complemental strand, 11978992 - 11978945
Alignment:
| Q |
157 |
atgaaattttatcggttggaaatatatttgtgtagtttatgatataat |
204 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
11978992 |
atgaaattttatcggttgtaaattgatttgtgtagtttatgatataat |
11978945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University