View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8757_high_8 (Length: 382)
Name: NF8757_high_8
Description: NF8757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8757_high_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 110 - 365
Target Start/End: Complemental strand, 34933655 - 34933409
Alignment:
| Q |
110 |
ctccaaggtatctatgtattttcattgcatgacagttttcgttcgtaatctcttgggttgaagcttcttataagtagaatgagaagaatttgttgaattt |
209 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34933655 |
ctccaacgtatctatgtattttcattgcatgatagttttcgttcgtaatctctagggttgaagcttcttataagtagaatgagaagaatttgt------- |
34933563 |
T |
 |
| Q |
210 |
gtctctctagggttgcattgcatgacagttttcgtttgtatctctttcaatcatattttcataatcgttgcttcattcgcaaggtatctatgtattttca |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34933562 |
--ctctctagggttgcattgcatgacagttttcgtttgtatctctttcaatcatattttcataatcgttgcttcactcgcaaggtatctatgtattttca |
34933465 |
T |
 |
| Q |
310 |
ttcttcttctttattttgtcaaaactcaagttgattatcatatatgtctctttctg |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34933464 |
ttcttcttctttattttgtcaaaactcaagttgattatcatatatgtctctttctg |
34933409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 114 - 302
Target Start/End: Complemental strand, 34927146 - 34926958
Alignment:
| Q |
114 |
aaggtatctatgtattttcattgcatgacagttttcgttcgtaatctcttgggttgaagcttcttataagtagaatgagaagaatttgttgaatttgtct |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
34927146 |
aaggtatctatgtaatttcattgcatgacagttttttttcgtaatctctagggttgaagcttcttatacgtagaatgagaagaatttgttgaacttgtct |
34927047 |
T |
 |
| Q |
214 |
ctctagggttgcattgcatgacagttttcgtttgtatctctttcaatcatattttcataatcgttgcttcattcgcaaggtatctatgt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
34927046 |
ctctagggttgcattgcatgacagttttcgttcttatctctttcaatcttattttcatattcgttgcttcactctcaaggtatctatgt |
34926958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 19 - 47
Target Start/End: Complemental strand, 34933755 - 34933727
Alignment:
| Q |
19 |
aagttttcattgcagcttctctgtgatgt |
47 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34933755 |
aagttttcattgcagcttctctgtgatgt |
34933727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University