View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8757_low_13 (Length: 352)
Name: NF8757_low_13
Description: NF8757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8757_low_13 |
 | |
|
| [»] scaffold0212 (1 HSPs) |
| | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 196 - 337
Target Start/End: Complemental strand, 1132372 - 1132230
Alignment:
| Q |
196 |
cgaggacaaaaggcctgatagcagacatgagccaactctaaggagggcacccccgaatgcataagagaggggttggaaaagcacctcga-gagaagcttc |
294 |
Q |
| |
|
||||||||||| |||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1132372 |
cgaggacaaaaagccttatagcagatatgagccaactcaaaggagggcacccccgaatgcataagagaggggttggaaaagcacctcgaggagaagcttc |
1132273 |
T |
|
| Q |
295 |
atttggaagttccgctcatcttgcttcatatttgttaattcat |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1132272 |
atttggaagttccgctcatcttgcttcatatttgttaattcat |
1132230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 168
Target Start/End: Complemental strand, 1132600 - 1132453
Alignment:
| Q |
18 |
aatactaacattaataataactatttgatgtctcttgaatatcaatgtgtcgtgtttgtctttttgctcactcaattgatcattatatttagtaacaatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||| ||| |
|
|
| T |
1132600 |
aatactaacattaataataactatttgatgtctcttgaatatcaatgtgtggtgtttgtctttttgctcactcaattgatcagtatctttagtaacgatc |
1132501 |
T |
|
| Q |
118 |
ttattttaaaatattttttgtcatcgttgtcgtcatcatcatccttgttgt |
168 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
1132500 |
ttattttaaaatattgtttgtcatcgtt---gtcatcatcatccttgttgt |
1132453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0212 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: scaffold0212
Description:
Target: scaffold0212; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 212 - 311
Target Start/End: Original strand, 1078 - 1177
Alignment:
| Q |
212 |
gatagcagacatgagccaactctaaggagggcacccccgaatgcataagagaggggttggaaaagcacctcgagagaagcttcatttggaagttccgctc |
311 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||| || ||||||||||| || |||||||||||| |
|
|
| T |
1078 |
gatagcagacatgagccaactcaaaggagggcacccccgaacgcataagagaggggttggaaaaggaccccgtgagaagcttcagttagaagttccgctc |
1177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 216
Target Start/End: Original strand, 54324 - 54352
Alignment:
| Q |
188 |
gttgcttacgaggacaaaaggcctgatag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54324 |
gttgcttacgaggacaaaaggcctgatag |
54352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University