View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8757_low_16 (Length: 293)
Name: NF8757_low_16
Description: NF8757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8757_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 30090949 - 30091183
Alignment:
| Q |
1 |
acacatcggtaccaattctagctgttggtttataaggaacaaaagcagcgagaactcttgatccaggtgccattatgtcaggcttcaaaatccatggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30090949 |
acacatcggtaccaattctagctgttggtttataaggaacaaaagcagcgagaactcttgatccaggtgccattatgtcaggcttcaaaatccaaggaaa |
30091048 |
T |
|
| Q |
101 |
gccatgtgatggacctcttgatgagtaatgagctgcaattggtgccggttttattccaagaaatgtttgttgaaacttaatgcttgctgttggattattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30091049 |
gccatgtgatggacctcttgatgagtaatgagctgcaattggtgccggttttattccaagaaatgtttgttgaaacttaatgcttgctgttggattattc |
30091148 |
T |
|
| Q |
201 |
ttattgcgttttgcgtacttgatcacaggttctgc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
30091149 |
ttattgcgttttgcgtacttgatcacagattctgc |
30091183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 12 - 196
Target Start/End: Complemental strand, 30099956 - 30099772
Alignment:
| Q |
12 |
ccaattctagctgttggtttataaggaacaaaagcagcgagaactcttgatccaggtgccattatgtcaggcttcaaaatccatggaaagccatgtgatg |
111 |
Q |
| |
|
|||||||||||||||||||| | ||||| | |||| || |||||||||||||||||||||||||| ||||| ||||||||||||||| ||| |||||| | |
|
|
| T |
30099956 |
ccaattctagctgttggtttgttaggaatataagctgcaagaactcttgatccaggtgccattatatcaggtttcaaaatccatggatagctatgtgaag |
30099857 |
T |
|
| Q |
112 |
gacctcttgatgagtaatgagctgcaattggtgccggttttattccaagaaatgtttgttgaaacttaatgcttgctgttggatt |
196 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||| ||| |||| | ||||||||||||||| || ||||||| ||| ||||| |
|
|
| T |
30099856 |
gacctcttgatgagtaatatgctgcagctggtgccggctttgttcctacaaatgtttgttgaaatttgatgcttgatgtaggatt |
30099772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University